<
Justice and Law concept. Legal counsel presents to the client a signed contract with gavel and legal law or legal having team meeting at law firm in background

Tips for Paralegals and Litigation Support Professionals – November 2023

Share this article

November 5, 2023: Regex to Change Case of Letters

Note that you can easily use a regular expression search to capitalize certain strings in text. In this example we have a list of names, and we want to capitalize the last names of each person. Using NotePad++, we target strings with a first initial and then a period and a space ([A-Z]{1}\. ) and then in the second group any word containing uppercase or lowercase letters of any length ([A-Za-z]*). For search group # 1 enclosed in parentheses, the letter range is listed in the brackets, and then the letter count for the word is given in braces {}. We escape the period with a backward slash because a period has a separate meaning in regex. For the second group, we search for any uppercase or lowercase letter, with the asterisk signifying any number of characters.

([A-Z]\. )([A-Za-z]*)

In the replace field we can then reference the first group and the second group as \1 and \2. Adding \u before the second group signifier will capitalize the first letter.

\1\u\2

Example of regex to change case of letters

Switching \u to \l will make the first letter of the word in the second group lowercase.

November 14, 2023: Excel Formula to Extract Email Addresses

Exceljet has a formula posted here, which is effective at extracting email addresses, and other strings, from text excerpts.

=TRIM(MID(SUBSTITUTE(A2,” “,REPT(” “,99)),MAX(1,FIND(“@”,SUBSTITUTE(A2,” “,REPT(” “,99)))-50),99))

Excel formula to extract email addresses

The formula works by pulling any word which includes the character that is a subject of the FIND formula, which in this case is the ‘@’ symbol. It works by adding spaces to the target cells – so this part of the formula:

SUBSTITUTE(A2,” “,REPT(” “,99))

. . . adds 99 spaces around each word:

Excel formula to extract email addresses

We SUBSTITUTE blank spaces in A2 with a space 99 times using the REPT formula. (The REPT formula just repeats whatever string you enter for a set number of times. I.e., =REPT(“cat”,10) gives: catcatcatcatcatcatcatcatcatcat). The number of spaces that are added sets a limit on the length of the string that can be pulled. This solution will not pull a word more than 100 characters in length.

The FIND formula then finds where in the cell the “@” or searched for term appears after the spaces have been added.

=FIND(“@”,SUBSTITUTE(A2,” “,REPT(” “,99)))

Excel formula to extract email addresses

The MID formula then extracts the text with the searched for term and the spaces around it:

=MID(SUBSTITUTE(A2,” “,REPT(” “,99)),MAX(1,FIND(“@”,SUBSTITUTE(A2,” “,REPT(” “,99)))-50),99)

Excel formula to extract email addresses

The TRIM formula then simply removes the extra spaces.

We can extract full words which contain the searched for string because the complete formula surrounds them with buffer blank spaces. They are then easy to target – once the position of one character or segment is located, it’s easy to extract the full word and then cut off the extra spaces.

The formula will also successfully locate words, or parts of words and turn the full word in which the segment appears.

Excel formula to extract email addresses

A #VALUE error will be given if the searched for text does not appear in the target cell.

November 21, 2023: Make Your Mobile Hotspot Faster

Keep in mind that if you’re using your phone’s mobile hotspot to get online with a laptop or other device the speed of the connection should improve if you tether uour cell phone. Connecting via a USB cord from the smartphone to the laptop will provide a cabled internet connection. This method can prevent drain on the laptop’s battery and will be more secure.

November 30, 2023: SEC Director of Enforcement on Penalties for Data Preservation Failures

In October 2023, the SEC’s Director of Enforcement Gurbir Grewal addressed the New York City Association.   See the transcript posted here.  In remarks which emphasized the need for businesses to be proactive in complying with financial regulations, the Director stressed the need to preserve electronic data.  In the past two years

the SEC has fined more than 40 companies over a $1.5 billion for failing to preserve electronic communications.  Most of the noncompliance was a result of employees failing to follow data preservation policies. A key problem was that communications were being conducted outside of official channels.

In December 2021, J.P. Morgan Securities had to pay a $125 million penalty because its employees were communicating about business using text messages, personal email, and WhatsApp, and no steps were taken to preserve the data.  The violation was particularly egregious because the individuals responsible for implementing J.P. Morgan’s policies communicated outside of official channels themselves.   In this press release, Gerwal warned businesses to, “scrutinize their document preservation processes and self-report failures”.   Businesses that find their data preservation processes fall short of the requirements of securities laws are encouraged to report the problem by emailing [email protected].
Gerwal pointed out that the ability of a company to provide the SEC with summaries of financial analyses, locate key documents, and make data custodians available for interviews may lead to a mitigation of the amount of penalties that they are ordered to pay.

Thanks to Amy Sellars of CBRE for pointing out Gerwal’s remarks at yesterday’s ACEDS webinar on the 2023 Legal Industry Collaboration Data Survey.

Sean O'Shea on Email
Sean O'Shea
Litigation Paralegal
Sean O’Shea began working as a litigation support analyst at Brobeck, Phleger & Harrison LLP in 1998, near the dawn of the electronic discovery era. From assisting clients with the implementation of information governance policies, to conducting electronic presentations for attorneys at trials, he has been involved in all aspects of litigation support work. Sean is a Relativity Certified Administrator and an ACEDS Certified E-Discovery Specialist. He’s currently employed as a litigation paralegal in New York City, and continues to advise attorneys on legal technology. Look for a new tip on each night on www.litigationsupporttipofthenight.com.

*The views expressed in this blog are those of the owner and do not reflect the views or opinions of the owner’s employer. All content provided on this blog is for informational purposes only. The owner of this blog makes no representations as to the accuracy or completeness of any information on this site or found by following any link on this site. The owner will not be liable for any errors or omissions in this information nor for the availability of this information. The owner will not be liable for any losses, injuries, or damages from the display or use of this information. This policy is subject to change at any time. The owner is not an attorney, and nothing posted on this site should be construed as legal advice. Litigation Support Tip of the Night does not provide confirmation that any e-discovery technique or conduct is compliant with legal, regulatory, contractual or ethical requirements.

Share this article